shRNA Adeno-associated Virus Serotype 2, p7SK-(C21orf93-shRNA-Seq2)(CAT#: AAV-SI1256WQ)

This product is a C21orf93-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C21orf93-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C21orf93-shRNA-Seq2
Related Target/Protein C21orf93
Region 3UTR
TargetSeq CCTTCTCCTATCCGGAAAGTA
NCBI RefSeq NM_145179
Alternative Names NCRNA00315; LINC00315
Titer >1*10^10 GC/mL
Target Gene
Gene ID 246704
Uniprot ID P59091

Related Products

Advertisement