shRNA Adeno-associated Virus Serotype 2, pH1-(2010110P09Rik-shRNA-Seq4)(CAT#: AAV-SI2930WQ)

This product is a 2010110P09Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2010110P09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2010110P09Rik-shRNA-Seq4
Related Target/Protein 2010110P09Rik
Region CDS
TargetSeq GCGCTTTGCATTTCAGCTCTA
NCBI RefSeq XM_355937
Alternative Names Cbhp2; Chp2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70261
Uniprot ID Q9D869

Related Products

Advertisement