shRNA Adeno-associated Virus Serotype 2, p7SK-(C8orf4-shRNA-Seq1)(CAT#: AAV-SI1063WQ)

This product is a C8orf4-shRNA encoding AAV, which is based on AAV-2 serotype. The C8orf4 gene encodes a small, monomeric, predominantly unstructured protein that functions as a positive regulator of the Wnt/beta-catenin signaling pathway. The expression of C8orf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C8orf4-shRNA-Seq1
Related Target/Protein C8orf4
Region CDS
TargetSeq GAGACAAGAAAGCAGAGGAGA
NCBI RefSeq NM_020130
Alternative Names TC1; TC-1; TCIM
Titer >1*10^10 GC/mL
Related Diseases Thyroid cancer, breast cancer and hematological malignancies
Target Gene
Gene ID 56892
Uniprot ID Q9NR00

Related Products