shRNA Adeno-associated Virus Serotype 2, p7SK-(PATL1-shRNA-Seq1)(CAT#: AAV-SI1105WQ)
This product is a PATL1-shRNA encoding AAV, which is based on AAV-2 serotype. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PATL1-shRNA-Seq1 |
| Related Target/Protein | PATL1 |
| Region | CDS |
| TargetSeq | CATTACCAAGGCGGTCAACTT |
| NCBI RefSeq | NM_152716 |
| Alternative Names | Pat1b; hPat1b |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatitis C virus (HCV) infection |
