shRNA Adeno-associated Virus Serotype 2, p7SK-(CCDC67-shRNA-Seq3)(CAT#: AAV-SI1198WQ)
This product is a CCDC67-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CCDC67-shRNA-Seq3 |
Related Target/Protein | CCDC67 |
Region | CDS |
TargetSeq | GCAATGACTCAGAATTATGAA |
NCBI RefSeq | NM_181645 |
Alternative Names | DEUP1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Papillary thyroid carcinoma, gastric cancer |