shRNA Adeno-associated Virus Serotype 2, pH1-(C14orf70-shRNA-Seq3)(CAT#: AAV-SI0991WQ)

This product is a C14orf70-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C14orf70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C14orf70-shRNA-Seq3
Related Target/Protein C14orf70
Region 3UTR
TargetSeq GAGCTCAGAAAGCTAAAGCAA
NCBI RefSeq NM_001007560
Alternative Names LINC00523
Titer >1*10^10 GC/mL
Related Diseases Type 2 diabetes
Target Gene
Gene ID 283601
Uniprot ID Q86TU6

Related Products

Advertisement