shRNA Adeno-associated Virus Serotype 2, p7SK-(CHRDL2-shRNA-Seq1)(CAT#: AAV-SI3226WQ)
This product is a CHRDL2-shRNA encoding AAV, which is based on AAV-2 serotype. The CHRDL2 gene encodes a member of the chordin family of proteins. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. The expression of CHRDL2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CHRDL2-shRNA-Seq1 |
| Related Target/Protein | CHRDL2 |
| Region | CDS |
| TargetSeq | CCTGAAGGAGAAACATAAGAA |
| NCBI RefSeq | NM_015424 |
| Alternative Names | BNF1; CHL2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | osteoarthritis |
