shRNA Adeno-associated Virus Serotype 2, p7SK-(CIAPIN1-shRNA-Seq1)(CAT#: AAV-SI1276WQ)

This product is a CIAPIN1-shRNA encoding AAV, which is based on AAV-2 serotype. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CIAPIN1-shRNA-Seq1
Related Target/Protein CIAPIN1
Region 3UTR
TargetSeq GAGTTGTTAGTTTACTCCATT
NCBI RefSeq NM_020313
Alternative Names DRE2; CIAE2; PRO0915; Anamorsin
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 57019
Uniprot ID Q6FI81

Related Products

Advertisement