shRNA Adeno-associated Virus Serotype 2, p7SK-(CRAMP1L-shRNA-Seq1)(CAT#: AAV-SI1382WQ)
This product is a CRAMP1L-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of CRAMP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CRAMP1L-shRNA-Seq1 |
Related Target/Protein | CRAMP1L |
Region | CDS |
TargetSeq | GATTACATTTCTCGGTTCAAT |
NCBI RefSeq | NM_020825 |
Alternative Names | HN1L; TCE4; CRAMP1L |
Titer | >1*10^10 GC/mL |
Related Diseases | Lamotrigine (LTG)-induced maculopapular eruption (MPE) |