shRNA Adeno-associated Virus Serotype 2, p7SK-(TREH-shRNA-Seq2)(CAT#: AAV-SI1372WQ)

This product is a TREH-shRNA encoding AAV, which is based on AAV-2 serotype. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TREH-shRNA-Seq2
Related Target/Protein TREH
Region CDS
TargetSeq CCTGACTTACCAGTATGGGAT
NCBI RefSeq NM_007180
Alternative Names TRE; TREA; TREHD
Titer >1*10^10 GC/mL
Related Diseases Motoneuron degeneration
Target Gene
Gene ID 11181
Uniprot ID O43280

Related Products