shRNA Adeno-associated Virus Serotype 2, p7SK-(Csprs-shRNA-Seq1)(CAT#: AAV-SI3708WQ)

This product is a Csprs-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Csprs-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Csprs-shRNA-Seq1
Related Target/Protein Csprs
Region CDS
TargetSeq CCATTGTCATTATCGCAATAG
NCBI RefSeq NM_033616
Alternative Names HSR; D1Lub1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 114564
Uniprot ID Q99388

Related Products