shRNA Adeno-associated Virus Serotype 2, p7SK-(Ptrh2-shRNA-Seq1)(CAT#: AAV-SI3927WQ)

This product is a Ptrh2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Ptrh2 gene is a mitochondrial protein with two putative domains and possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. The expression of Ptrh2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ptrh2-shRNA-Seq1
Related Target/Protein Ptrh2
Region CDS
TargetSeq CCAGATGAAGACACCCTCATT
NCBI RefSeq NM_175004
Alternative Names PTH; BIT1; PTH2; PTH 2; CFAP37; IMNEPD; CGI-147
Titer >1*10^10 GC/mL
Related Diseases Pancreatic disease (INMEPD)
Target Gene
Gene ID 51651
Uniprot ID Q9Y3E5

Related Products

Inquiry Now
Advertisement