shRNA Adeno-associated Virus Serotype 2, p7SK-(DDX10-shRNA-Seq1)(CAT#: AAV-SI1149WQ)
This product is a DDX10-shRNA encoding AAV, which is based on AAV-2 serotype. DDX10 gene is implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. The expression of DDX10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | DDX10-shRNA-Seq1 |
Related Target/Protein | DDX10 |
Region | CDS |
TargetSeq | CCAGTGCTGGAAGCCTTATAT |
NCBI RefSeq | NM_004398 |
Alternative Names | Dbp4; HRH-J8 |
Titer | >1*10^10 GC/mL |
Related Diseases | Myeloid malignancies |