shRNA Adeno-associated Virus Serotype 2, p7SK-(Dos-shRNA-Seq1)(CAT#: AAV-SI3994WQ)

This product is a Dos-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Dos gene negatively regulates voltage-gated calcium channels by preventing the interaction between their alpha and beta subunits. The expression of Dos-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Dos-shRNA-Seq1
Related Target/Protein Dos
Region CDS
TargetSeq GCCGACTTCATTCAGTACATT
NCBI RefSeq NM_015761
Alternative Names DOS; BARP; C19orf26; CBARP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 255057
Uniprot ID Q8N350

Related Products