shRNA Adeno-associated Virus Serotype 2, p7SK-(MICALCL-shRNA-Seq3)(CAT#: AAV-SI1088WQ)
This product is a MICALCL-shRNA encoding AAV, which is based on AAV-2 serotype. The MICALCL gene may cooperate with MAPK1/ERK2 via an intracellular signal transduction pathway in the morphogenetic development of round spermatids to spermatozoa and act as Rab effector protein and play a role in vesicle trafficking. The expression of MICALCL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | MICALCL-shRNA-Seq3 |
| Related Target/Protein | MICALCL |
| Region | CDS |
| TargetSeq | CCCAGCTTTCCTTGCAGTTAA |
| NCBI RefSeq | NM_032867 |
| Alternative Names | Ebitein1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal cancer |
