shRNA Adeno-associated Virus Serotype 2, p7SK-(EWSR1-shRNA-Seq1)(CAT#: AAV-SI1036WQ)
This product is a EWSR1-shRNA encoding AAV, which is based on AAV-2 serotype. The EWSR1 gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The expression of EWSR1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | EWSR1-shRNA-Seq1 |
Related Target/Protein | EWSR1 |
Region | 3UTR |
TargetSeq | TGCATTGACTACCAGATTTAT |
NCBI RefSeq | NM_005243 |
Alternative Names | EWS; EWS-FLI1; bK984G1.4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ewing sarcoma as well as neuroectodermal tumors |