shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM129C-shRNA-Seq3)(CAT#: AAV-SI1431WQ)

This product is a FAM129C-shRNA encoding AAV, which is based on AAV-2 serotype. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM129C-shRNA-Seq3
Related Target/Protein FAM129C
Region CDS
TargetSeq CGTGTGTTCTTGGTTCAGCTT
NCBI RefSeq NM_173544
Alternative Names BCNP1; FAM129C
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancer
Target Gene
Gene ID 199786
Uniprot ID Q86XR2

Related Products

Advertisement