shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM36A-shRNA-Seq2)(CAT#: AAV-SI1501WQ)

This product is a FAM36A-shRNA encoding AAV, which is based on AAV-2 serotype. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM36A-shRNA-Seq2
Related Target/Protein FAM36A
Region CDS
TargetSeq CAAAGCAAAGAATCCAGGAAA
NCBI RefSeq NM_198076
Alternative Names COX20
Titer >1*10^10 GC/mL
Related Diseases Mitochondrial complex IV deficiency
Target Gene
Gene ID 116228
Uniprot ID Q5RI15

Related Products