shRNA Adeno-associated Virus Serotype 2, p7SK-(GEMIN8-shRNA-Seq1)(CAT#: AAV-SI1171WQ)

This product is a GEMIN8-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by GEMIN8 gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The expression of GEMIN8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert GEMIN8-shRNA-Seq1
Related Target/Protein GEMIN8
Region CDS
TargetSeq GAGTCAGATGCAGAGGTAGAA
NCBI RefSeq NM_017856
Alternative Names FAM51A1
Titer >1*10^10 GC/mL
Related Diseases Survival motor neuron (SMN)
Target Gene
Gene ID 54960
Uniprot ID Q9NWZ8

Related Products

Inquiry Now
Advertisement