shRNA Adeno-associated Virus Serotype 2, p7SK-(Hsp7SK-shRNA-Seq3)(CAT#: AAV-SI3667WQ)
This product is a Hsph1-shRNA encoding AAV, which is based on AAV-2 serotype. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Hsph1-shRNA-Seq3 |
Related Target/Protein | Hsph1 |
Region | CDS |
TargetSeq | GCCAACTTGGTATGGCAGTTA |
NCBI RefSeq | NM_013559 |
Alternative Names | HSP105; HSP105A; HSP105B; NY-CO-25 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |