shRNA Adeno-associated Virus Serotype 2, p7SK-(Iqcf4-shRNA-Seq1)(CAT#: AAV-SI3933WQ)

This product is a Iqcf4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Iqcf4 gene has calmodulin binding ability. The expression of Iqcf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Iqcf4-shRNA-Seq1
Related Target/Protein Iqcf4
Region CDS
TargetSeq GACATAAAGGAAACAAGGAAA
NCBI RefSeq NM_026090
Alternative Names mtIQ1; 1700042N06Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 67320
Uniprot ID Q6P8Y2

Related Products