shRNA Adeno-associated Virus Serotype 2, p7SK-(JMJD4-shRNA-Seq1)(CAT#: AAV-SI1116WQ)

This product is a JMJD4-shRNA encoding AAV, which is based on AAV-2 serotype. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert JMJD4-shRNA-Seq1
Related Target/Protein JMJD4
Region CDS
TargetSeq CAATGTCTGTGGGAGGAAGAA
NCBI RefSeq NM_023007
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 65094
Uniprot ID Q9H9V9

Related Products

Inquiry Now
Advertisement