shRNA Adeno-associated Virus Serotype 2, p7SK-(KCTD2-shRNA-Seq1)(CAT#: AAV-SI1418WQ)
This product is a KCTD2-shRNA encoding AAV, which is based on AAV-2 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KCTD2-shRNA-Seq1 |
| Related Target/Protein | KCTD2 |
| Region | CDS |
| TargetSeq | CCTACTTTGGTCCTATCCTCA |
| NCBI RefSeq | NM_015353 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ischaemic Stroke and Alzheimer's Disease |
