shRNA Adeno-associated Virus Serotype 2, p7SK-(KIAA1841-shRNA-Seq1)(CAT#: AAV-SI1220WQ)

This product is a KIAA1841-shRNA encoding AAV, which is based on AAV-2 serotype. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KIAA1841-shRNA-Seq1
Related Target/Protein KIAA1841
Region 3UTR
TargetSeq CCATGCATGTTGTTATACTTT
NCBI RefSeq NM_032506
Titer >1*10^10 GC/mL
Related Diseases Lung adenocarcinoma
Target Gene
Gene ID 84542
Uniprot ID Q6NSI8

Related Products

Advertisement