shRNA Adeno-associated Virus Serotype 2, p7SK-(Nkd1-shRNA-Seq1)(CAT#: AAV-SI4033WQ)

This product is a Nkd1-shRNA encoding AAV, which is based on AAV-2 serotype. The Nkd1 gene may activate a second Wnt signaling pathway that controls planar cell polarity. The expression of Nkd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Nkd1-shRNA-Seq1
Related Target/Protein Nkd1
Region CDS
TargetSeq CACCATTACCACCACTTCTAT
NCBI RefSeq NM_027280
Alternative Names Naked1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 85407
Uniprot ID Q969G9

Related Products

Inquiry Now
Advertisement