shRNA Adeno-associated Virus Serotype 2, p7SK-(NLRP9-shRNA-Seq2)(CAT#: AAV-SI3216WQ)
This product is a NLRP9-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by NLRP9 gene belongs to the NALP protein family. This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. The expression of NLRP9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | NLRP9-shRNA-Seq2 |
Related Target/Protein | NLRP9 |
Region | 3UTR |
TargetSeq | CGTCTCACAAAGGCTTTCCTT |
NCBI RefSeq | NM_176820 |
Alternative Names | NOD6; NALP9; PAN12; CLR19.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Immune system disease |