shRNA Adeno-associated Virus Serotype 2, p7SK-(NSMAF-shRNA-Seq1)(CAT#: AAV-SI3409WQ)

This product is a NSMAF-shRNA encoding AAV, which is based on AAV-2 serotype. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert NSMAF-shRNA-Seq1
Related Target/Protein NSMAF
Region 3UTR
TargetSeq GCCATTAGTTGCTATTCTCTT
NCBI RefSeq NM_003580
Alternative Names FAN; GRAMD5
Titer >1*10^10 GC/mL
Related Diseases Inflammation
Target Gene
Gene ID 8439
Uniprot ID Q92636

Related Products

Inquiry Now
Advertisement