shRNA Adeno-associated Virus Serotype 2, pU6-(Rtn4ip1-shRNA-Seq1)(CAT#: AAV-SI2252WQ)

This product is a Rtn4ip1-shRNA encoding AAV, which is based on AAV-2 serotype. The Rtn4ip1 gene encodes a mitochondrial protein that interacts with reticulon 4, which is a potent inhibitor of regeneration following spinal cord injury. The expression of Rtn4ip1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Rtn4ip1-shRNA-Seq1
Related Target/Protein Rtn4ip1
Region CDS
TargetSeq GAACATGATGTTACCTATCAT
NCBI RefSeq NM_130892
Alternative Names NIMP; OPA10
Titer >1*10^10 GC/mL
Related Diseases Optic atrophy
Target Gene
Gene ID 84816
Uniprot ID Q8WWV3

Related Products

Inquiry Now
Advertisement