shRNA Adeno-associated Virus Serotype 2, p7SK-(Peo1-shRNA-Seq3)(CAT#: AAV-SI3542WQ)
This product is a Peo1-shRNA encoding AAV, which is based on AAV-2 serotype. The gene Peo1 encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The expression of Peo1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Peo1-shRNA-Seq3 |
Related Target/Protein | Peo1 |
Region | CDS |
TargetSeq | CGATTCAGTGTCCGCTATCTT |
NCBI RefSeq | NM_153796 |
Alternative Names | PEO; TWNK; SCA8; ATXN8; IOSCA; PEOA3; SANDO; TWINL; MTDPS7; PRLTS5; C10orf2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infantile onset spinocerebellar ataxia (IOSCA), Progressive external ophthalmoplegia (PEO), Several mitochondrial depletion syndromes |