shRNA Adeno-associated Virus Serotype 2, p7SK-(Pramel1-shRNA-Seq1)(CAT#: AAV-SI3999WQ)

This product is a Pramel1-shRNA encoding AAV, which is based on AAV-2 serotype. The Pramel1 gene may play a role in acrosome development and also in sperm maturation and motility. The expression of Pramel1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Pramel1-shRNA-Seq1
Related Target/Protein Pramel1
Region CDS
TargetSeq CTACAGGAGAATCTTAGAGAT
NCBI RefSeq NM_031377
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 83491
Uniprot ID Q99MW3

Related Products

Inquiry Now
Advertisement