shRNA Adeno-associated Virus Serotype 2, pU6-(S1pr4-shRNA-Seq1)(CAT#: AAV-SI2323WQ)

This product is a S1pr4-shRNA encoding AAV, which is based on AAV-2 serotype. The S1pr4 gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. The expression of S1pr4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert S1pr4-shRNA-Seq1
Related Target/Protein S1pr4
Region CDS
TargetSeq CTCATTGTCCTGCACTACAAT
NCBI RefSeq NM_010102
Alternative Names EDG6; LPC1; S1P4; SLP4
Titer >1*10^10 GC/mL
Related Diseases Lymphoma
Target Gene
Gene ID 8698
Uniprot ID O95977

Related Products

Inquiry Now
Advertisement