shRNA Adeno-associated Virus Serotype 2, p7SK-(RNPS1-shRNA-Seq1)(CAT#: AAV-SI1051WQ)
This product is a RNPS1-shRNA encoding AAV, which is based on AAV-2 serotype. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | RNPS1-shRNA-Seq1 |
| Related Target/Protein | RNPS1 |
| Region | 3UTR |
| TargetSeq | GAAGACCAGTAGGAAAGCAAA |
| NCBI RefSeq | NM_006711 |
| Alternative Names | E5.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neuro-developmental disorders |
