shRNA Adeno-associated Virus Serotype 2, p7SK-(CCDC84-shRNA-Seq1)(CAT#: AAV-SI4040WQ)

This product is a CCDC84-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC84 gene encodes a protein thought to contain a coiled coil motif. The expression of CCDC84-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CCDC84-shRNA-Seq1
Related Target/Protein CCDC84
Region CDS
TargetSeq GCACAAGAAAGCAACCAACAA
NCBI RefSeq NM_198489
Alternative Names DLNB14
Titer >1*10^10 GC/mL
Target Gene
Gene ID 338657
Uniprot ID Q86UT8

Related Products

Advertisement