shRNA Adeno-associated Virus Serotype 2, p7SK-(RPRM-shRNA-Seq2)(CAT#: AAV-SI1413WQ)
This product is a RPRM-shRNA encoding AAV, which is based on AAV-2 serotype. The RPRM gene may be involved in the regulation of p53-dependent G2 arrest of the cell cycle. The expression of RPRM-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | RPRM-shRNA-Seq2 |
Related Target/Protein | RPRM |
Region | 3UTR |
TargetSeq | GAACTTTGGAAGCTGCTACTT |
NCBI RefSeq | NM_019845 |
Alternative Names | REPRIMO |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung carcinoma |