shRNA Adeno-associated Virus Serotype 2, p7SK-(Ktn1-shRNA-Seq3)(CAT#: AAV-SI3447WQ)

This product is a Ktn1-shRNA encoding AAV, which is based on AAV-2 serotype. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ktn1-shRNA-Seq3
Related Target/Protein Ktn1
Region CDS
TargetSeq CTCATCCCTTCAGTAGTTATT
NCBI RefSeq NM_008477
Alternative Names CG1; KNT; MU-RMS-40.19
Titer >1*10^10 GC/mL
Target Gene
Gene ID 3895
Uniprot ID Q86UP2

Related Products

Inquiry Now
Advertisement