shRNA Adeno-associated Virus Serotype 2, p7SK-(SPEM1-shRNA-Seq1)(CAT#: AAV-SI3887WQ)
This product is a SPEM1-shRNA encoding AAV, which is based on AAV-2 serotype. The SPEM1 gene is required for proper cytoplasm removal during spermatogenesis. The expression of SPEM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SPEM1-shRNA-Seq1 |
| Related Target/Protein | SPEM1 |
| Region | 3UTR |
| TargetSeq | GTGAACTCAGAAACTGAGAAA |
| NCBI RefSeq | NM_199339 |
| Alternative Names | C17orf83 |
| Titer | >1*10^10 GC/mL |
