shRNA Adeno-associated Virus Serotype 2, p7SK-(TDRD7-shRNA-Seq2)(CAT#: AAV-SI1349WQ)
This product is a TDRD7-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by TDRD7 gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. The expression of TDRD7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | TDRD7-shRNA-Seq2 |
Related Target/Protein | TDRD7 |
Region | 3UTR |
TargetSeq | CCTTGACAACTAATTCAGATT |
NCBI RefSeq | NM_014290 |
Alternative Names | TRAP; CATC4; PCTAIRE2BP |
Titer | >1*10^10 GC/mL |
Related Diseases | Congenital cataract and nonobstructive azoospermia |