shRNA Adeno-associated Virus Serotype 2, p7SK-(NCRNA00085-shRNA-Seq1)(CAT#: AAV-SI1111WQ)

This product is a NCRNA00085-shRNA encoding AAV, which is based on AAV-2 serotype. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert NCRNA00085-shRNA-Seq1
Related Target/Protein NCRNA00085
Region CDS
TargetSeq CGCATCTGCCAGATGTTTGTT
NCBI RefSeq NM_207324
Alternative Names LET7EH; SPACA6P; LINC00085; SPACA6
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 147650
Uniprot ID W5XKT8

Related Products