shRNA Adeno-associated Virus Serotype 2, p7SK-(TMEM44-shRNA-Seq1)(CAT#: AAV-SI1467WQ)

This product is a TMEM44-shRNA encoding AAV, which is based on AAV-2 serotype. TMEM44 gene encodes a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. The expression of TMEM44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TMEM44-shRNA-Seq1
Related Target/Protein TMEM44
Region CDS
TargetSeq CGCTGCTTCTCTATCTGAGAT
NCBI RefSeq NM_138399
Titer >1*10^10 GC/mL
Target Gene
Gene ID 93109
Uniprot ID Q2T9K0

Related Products

Advertisement