shRNA Adeno-associated Virus Serotype 2, p7SK-(VRTN-shRNA-Seq2)(CAT#: AAV-SI1103WQ)

This product is a VRTN-shRNA encoding AAV, which is based on AAV-2 serotype. VRTN is required for the development of thoracic vertebrae in mammals. VRTN is a novel DNA-binding transcription factor as it localizes exclusively in the nucleus, binds to DNA on a genome-wide scale and regulates the transcription of a set of genes that harbor VRTN binding motifs. The expression of VRTN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert VRTN-shRNA-Seq2
Related Target/Protein VRTN
Region CDS
TargetSeq CCAAGTTGTACCTGGAGCATT
NCBI RefSeq NM_018228
Alternative Names vertnin; C14orf115
Titer >1*10^10 GC/mL
Related Diseases Development of Thoracic Vertebrae in Mammals
Target Gene
Gene ID 55237
Uniprot ID Q9H8Y1

Related Products

Inquiry Now
Advertisement