shRNA Adeno-associated Virus Serotype 2, p7SK-(XIRP1-shRNA-Seq1)(CAT#: AAV-SI3263WQ)

This product is a XIRP1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by XIRP1 gene is a striated muscle protein and belongs to the Xin actin-binding repeat-containing protein (XIRP) family. The protein functions to protect actin filaments during depolymerization. The expression of XIRP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert XIRP1-shRNA-Seq1
Related Target/Protein XIRP1
Region CDS
TargetSeq GAGTCAAGTCAAGATCAGAAA
NCBI RefSeq NM_194293
Alternative Names Xin; CMYA1
Titer >1*10^10 GC/mL
Related Diseases Cardiovascular disease
Target Gene
Gene ID 165904
Uniprot ID Q702N8

Related Products

Inquiry Now
Advertisement