shRNA Adeno-associated Virus Serotype 2, pH1-(AI837181-shRNA-Seq2)(CAT#: AAV-SI2681WQ)

This product is a AI837181-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of AI837181-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert AI837181-shRNA-Seq2
Related Target/Protein AI837181
Region CDS
TargetSeq GCTCACTTACAAACCTGATGT
NCBI RefSeq NM_134149
Alternative Names Bles03; N28173
Titer >1*10^10 GC/mL
Target Gene
Gene ID 107242
Uniprot ID Q8VD62

Related Products

Advertisement