shRNA Adeno-associated Virus Serotype 2, pH1-(Armc5-shRNA-Seq1)(CAT#: AAV-SI3184WQ)

This product is a Armc5-shRNA encoding AAV, which is based on AAV-2 serotype. The Armc5 gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. The expression of Armc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Armc5-shRNA-Seq1
Related Target/Protein Armc5
Region 3UTR
TargetSeq CCAGGATGAAGATCTAACGAT
NCBI RefSeq NM_146205
Alternative Names AIMAH2
Titer >1*10^10 GC/mL
Related Diseases ACTH-independent macronodular adrenal hyperplasia 2
Target Gene
Gene ID 79798
Uniprot ID Q96C12

Related Products

Advertisement