shRNA Adeno-associated Virus Serotype 2, pH1-(C22orf33-shRNA-Seq3)(CAT#: AAV-SI0712WQ)

This product is a C22orf33-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C22orf33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C22orf33-shRNA-Seq3
Related Target/Protein C22orf33
Region CDS
TargetSeq CAGAAAGCACTGGAAGAGAAA
NCBI RefSeq NM_178552
Alternative Names EAN57; TEX33; cE81G9.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 339669
Uniprot ID O43247

Related Products

Inquiry Now
Advertisement