shRNA Adeno-associated Virus Serotype 2, pH1-(DKFZp434P055-shRNA-Seq2)(CAT#: AAV-SI0829WQ)

Datasheet

This product is a DKFZp434P055-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of DKFZp434P055-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DKFZp434P055-shRNA-Seq2
Related Target/Protein DKFZp434P055
Region CDS
TargetSeq GCAAACAAAGCTAGATCACAT
NCBI RefSeq NM_173466
Titer >1*10^10 GC/mL

Related Products

AAV1-VGATp (MCS-EGFP-3Flag)-SV40 PolyA (CAT#:AAV-GTK0039WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(TTC21A-shRNA-Seq1) (CAT#:AAV-SI0789WQ) AAV PHP.S-CMV βGlobin (MCS)-SV40 PolyA (CAT#:AAV-GTK0702WQ) Recombinant adeno-associated virus type 2, pU6-(Human hsa-mir-512-2), Overexpression (CAT#:AAV-GTOH0218WQ) Recombinant adeno-associated virus type 2, pU6-(Mouse Tpsb2), Overexpression (CAT#:AAV-GTOH0173WQ) AAV PHP.S-CMV βGlobin (EGFP-MCS)-hGH polyA (CAT#:AAV-GTK0679WQ) Recombinant adeno-associated virus type 9, pU6-(Human babo), Overexpression (CAT#:AAV-GTOH1265WQ) AAV2-ACTA1p (MCS-EGFP-3Flag)-SV40 PolyA, NC (CAT#:AAV-GTK0129WQ)