shRNA Adeno-associated Virus Serotype 2, pH1-(C9orf23-shRNA-Seq2)(CAT#: AAV-SI0819WQ)
This product is a C9orf23-shRNA encoding AAV, which is based on AAV-2 serotype. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C9orf23-shRNA-Seq2 |
Related Target/Protein | C9orf23 |
Region | CDS |
TargetSeq | GCTACGTTTCCTTCAGACTGA |
NCBI RefSeq | NM_148178 |
Alternative Names | RPP25L; bA296L22.5 |
Titer | >1*10^10 GC/mL |