shRNA Adeno-associated Virus Serotype 2, pH1-(CAMSAP1-shRNA-Seq2)(CAT#: AAV-SI0804WQ)
This product is a CAMSAP1-shRNA encoding AAV, which is based on AAV-2 serotype. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CAMSAP1-shRNA-Seq2 |
Related Target/Protein | CAMSAP1 |
Region | CDS |
TargetSeq | GAAGAGGAGCTTGTGGCTATT |
NCBI RefSeq | NM_015447 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |