shRNA Adeno-associated Virus Serotype 2, p7SK-(Olfr1163-shRNA-Seq4)(CAT#: AAV-SI3718WQ)

This product is a Olfr1163-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr1163 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1163-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Olfr1163-shRNA-Seq4
Related Target/Protein Olfr1163
Region CDS
TargetSeq CAACCACTTCTTCTGTGAATA
NCBI RefSeq NM_146644
Alternative Names MOR174-8
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258638
Uniprot ID Q8VFR4

Related Products

Inquiry Now
Advertisement