shRNA Adeno-associated Virus Serotype 2, pH1-(CCT3-shRNA-Seq1)(CAT#: AAV-SI2952WQ)
This product is a CCT3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by CCT3 gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). The expression of CCT3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CCT3-shRNA-Seq1 |
Related Target/Protein | CCT3 |
Region | CDS |
TargetSeq | GACATCGTTTCAGGCCACAAA |
NCBI RefSeq | NM_005998 |
Alternative Names | CCTG; PIG48; TRIC5; CCT-gamma; TCP-1-gamma |
Titer | >1*10^10 GC/mL |