shRNA Adeno-associated Virus Serotype 2, pH1-(CDCA3-shRNA-Seq3)(CAT#: AAV-SI0625WQ)

This product is a CDCA3-shRNA encoding AAV, which is based on AAV-2 serotype. CDCA3 is a potential prognostic marker that promotes cell proliferation in gastric cancer. CDCA3 overexpression resulted in the stimulation of cell growth and colony formation in vitro and xenograft tumors in vivo. Conversely, knockdown of CDCA3 inhibited these effects. The expression of CDCA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CDCA3-shRNA-Seq3
Related Target/Protein CDCA3
Region CDS
TargetSeq CTCCCAGATCTTCAGGTTCTA
NCBI RefSeq NM_031299
Alternative Names GRCC8; TOME-1
Titer >1*10^10 GC/mL
Related Diseases Gastric cancer
Target Gene
Gene ID 83461
Uniprot ID Q99618

Related Products